| Abstract Detail
Plant Protection Crosslin, James [1], Gieck, S. [2], David, Nick [3], Hamm, Philip [2], Ingham, Russ [4]. Delayed Emergence, Severe Stunting and Foliar Symptoms in Potato Due to Tobacco Rattle Virus. STUNTED plants surrounding areas with delayed emergence were observed in May 2005 in an irrigated potato field in Morrow County, Oregon. Half of the field was planted with cv. Russet Norkotah (RN) and half with cv. Ranger Russet (RR). Stunted plants often exhibited leaf chlorosis and yellow rings or chevrons. Foliar symptoms were more severe in RN, while more stunted plants or delayed emergence were present in RR. Few tubers associated with stunted plants showed symptoms of corky ringspot, caused by Tobacco rattle virus (TRV) which is vectored by the stubby-root nematode, (Paratrichodorus spp.). Soil near plants with and without foliar symptoms contained an average of 59 and 5 Paratrichodorus spp./100 grams dry soil, respectively. Tissues of both varieties from affected areas were positive by RT-PCR with primers TRV1 (5’ CAGTCTATACACAGAAACAGA 3’) and TRV2 (5’GACGTGTGTACTCAAGGGTT 3’), whereas tissues from unaffected plants were not. Symptomatic RN samples positive for TRV with primers TRV1/TRV2 were negative for TRV by ELISA and RT-PCR with primers TRV CP1 (5’ATTAGGGATTCGGACGC 3’) and TRV CP2 (5’ ATCACAAGCGATGGTGG 3’) which target the coat protein region of the TRV genome, suggesting this was a non-multiplying (NM)-type isolate of TRV. Symptomatic plants were negative for other viruses. Mechanical inoculations of symptomatic RN tissue to tobacco were negative, supporting the hypothesis that an NM-type isolate was present. This is the first time foliar symptoms due to TRV have been observed on potatoes in the Pacific Northwest.
Log in to add this item to your schedule
1 - United States Department of Agriculture, Agricultural Research Service, Forage and Vegetable Crop Research Unit, 24106 N. Bunn Road, Prosser, WA, 99350, USA
2 - Oregon State University, Hermiston Agricultural Research and Extension Center, P.O. Box 105, Hermiston, Oregon, 97838, USA
3 - Oregon State University, Botany & Plant Pathology, PO Box 105, Hermiston, OR, 97838, USA
4 - Oregon State University, Department of Botany and Plant Pathology, Corvallis, OR, 97331, USA
Keywords:
Tobacco rattle virus
Paratrichodorus.
Session: PAA02a-7
Location: Hall of Ideas Room E/Monona Terrace
Date: Monday, July 24th, 2006
Time: 3:30 PM
Abstract ID:70 |
